intranet:

Incase anything happens to my account here’s my entire genome:

GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…

snaxattacks:

c1qfxugcgy0:

c1qfxugcgy0:

image

Ha ha, no, of course not.

Yahoo is a notorious repeat offender. Yahoo is the reason the “if you’re not paying money for a service, then you’re not a customer, you’re the product.” saying exists.

Here is some fully general advice: If you’re the user of a free-to-use website, and you learn that it’s being bought by a large company, then this is always, and forever, bad news. If it’s not an acquihire, then it’s something worse. You’re not a customer, you’re the product.

If we’re lucky, this will be a Livejournal-style buyout, where the site just gradually disintegrates over the course of several years. If we’re unlucky, then it’ll be a Posterous-style buyout, and Tumblr will be shut down when Yahoo goes bankrupt in six months. It is vanishingly unlikely that being owned by Yahoo will benefit Tumblr users at all.

Predictions:

  1. More ads. Karp has a weirdly principled dislike of ads, for a guy running a free social network. Marissa Mayer is unencumbered by morals, here. If you spend a billion dollars on something, you’re gonna want a return on income.
  2. NSFW content is probably going to be banned, or heavily restricted. (As in, “verify your age by giving us a credit card number”) Ad networks hate and fear porn, and Yahoo is going to run more ads. No other Yahoo property allows NSFW content, for precisely this reason.
  3. They might try to restrict fan content, due to copyright/CP concerns, as Livejournal did; they might not.
  4. Dogs and cats living together. Mass hysteria!

I called it, five years in advance.

The prophecy was right there and we all ignored it.

kalpico:

i hate that i’m so absent as a person. i don’t start conversations. i can barely maintain them. i’m so weary and spaced out all the time to the point where i can’t even keep up small talk and i’m just so disappointed in myself